|
|
||||||||
and enhances the receptors transcriptional activity
1 Departments of Molecular Biology, Institute of Basic Medicine,
2 Obstetrics and Gynecology and
3 Endocrinology, Chinese PLA General Hospital, Beijing 100853, China
4 Department of Medicine and Bioregulatory Science, Graduate School of Medical Science, Kyushu University, Fukuoka 812-8582, Japan
(Correspondence should be addressed to Y-M Mu; Email: muyiming{at}301hospital.com.cn)
| Abstract |
|---|
|
|
|---|
(ER
)-positive MCF-7 cells not only inhibits cells growth, but also significantly attenuates the cell lines estrogen-responsive proliferation ability. However, ectopic expression of LRP16 in ER
-negative MDA-MB-231 cells has no effect on proliferation. These data suggest the involvement of LRP16 in estrogen signaling. We also provide novel evidence by both ectopic expression and small interfering RNA knockdown approaches that LRP16 enhances ER
-mediated transcription activity. In stably LRP16-inhibitory MCF-7 cells, the estrogen-induced upregulation of several well-known ER
target genes including cyclin D1 and c-myc is obviously impaired. Results from glutathione S-transferase pull-down and coimmunoprecipitation assays revealed that LRP16 physically interacts with ER
in a manner that is estrogen independent but is enhanced by estrogen. Furthermore, a mammalian two-hybrid assay indicated that the binding region of LRP16 localizes to the A/B activation function 1 domain of ER
. Taken together, these results present new data supporting a role for estrogenically regulated LRP16 as an ER
coactivator, providing a positive feedback regulatory loop for ER
signal transduction.
| Introduction |
|---|
|
|
|---|
and ß (ER
and ß; Mangelsdorf et al. 1998, McDonnell & Norris 2002). The activation of an ER results in an altered expression of its direct transcriptional targets, thereby affecting downstream secondary biological activities. It is believed that 75% of carcinoma in situ breast lesions and similar percentages of invasive breast cancers express elevated levels of ER
protein; whereas in normal breast epithelial cells, only 10% of cells express ER
and only at low levels (Allred et al. 2001). Patients expressing elevated levels of ER
are therefore suitable candidates for hormonal therapy, which aims to block estrogen stimulation of breast cancer cells (Deroo & Korach 2006).
ER
contains six domains named A through F. The structure of ER
is similar to that of other nuclear receptors (NRs), having three separate functional domains; a variable activation function 1 domain (AF-1) in the N-terminal A/B domain, a central DNA-binding domain (LBD, ligand-binding domain) located in the C domain and a C-terminal LBD, domain E that contains AF-2 (Nilsson et al. 2001). The AF-1 domain is regulated by growth factors and its activity depends on the cellular and promoter context, while the AF-2 domain is dependent on ligand binding (Lees et al. 1989, Shao & Brown 2004). The two activating domains act synergistically to generate maximum transcriptional activity of ER
(Danielian et al. 1992, Métivier et al. 2001). ER
-mediated transcription is a highly complex process involving multiple of coregulatory factors (Hall et al. 2001, Hall & McDonnell 2005). The cofactors can be broadly divided into subgroups of either coactivator which augments the function of an activated receptor or corepressors which sustain the inactivated state of a receptor. Transcriptional activation of ER
involves interactions with coactivator molecules and the basal transcription machinery in a sequential and cyclic fashion at the promoter region of responsive genes (Glass & Rosenfeld 2000, Shang et al. 2000, McKenna & OMalley 2002, Métivier et al. 2003). The balance of ER
cofactors in target cells, coupled with different concentrations of ER
and its ligand, allows fine-tuning of target gene transcription in response to estrogen. Over the past decade, more than 20 coactivator molecules have been identified using biochemical approaches as well as yeast two-hybrid screens (Klinge 2000, Shao & Brown 2004). Most of the coactivators bind to the ER
AF-2 domain in a ligand-dependent fashion. Only two related coactivators specific to ER
AF-1 have been identified to date, p68 and p72 RNA helicases (Endoh et al. 1999, Watanabe et al. 2001). The LRP16 gene was originally isolated from human lymphocyte cells, and was identified as an estrogen-responsive gene by our group (Han et al. 2003). We have previously documented that 17ß-estradiol (E2) upregulated the leukemia related protein 16 (LRP16) mRNA level in an ER
-dependent manner in MCF-7 human breast cancer cells (Han et al. 2003). One-half of the estrogen response element (ERE)/GC-rich Sp1-binding site and several GC-rich Sp1-binding sites within the promoter region of LRP16 gene were identified as the main contributors to the E2-responsive regulatory mechanism (Zhao et al. 2005, Si et al. 2006). Overexpression of LRP16 significantly stimulated MCF-7 cell proliferation by promoting the transition of G1 to S (Han et al. 2003). In primary breast cancer samples, our data indicated that LRP16 mRNA was overexpressed in nearly 40% of all samples. The clinicopathologic characteristics, including ER
/PR status, tumor diameter, and the involvement of axillary lymphoid nodes were tightly linked with LRP16 mRNA overexpression (Liao et al. 2006). Taken together, these data implied that LRP16 may play an important role in carcinogenesis and/or progression of hormone-dependent breast cancer.
The goal of this study was to gain an understanding of the functional role of LRP16 in hormone-sensitive breast cancer cells. To do this, we investigated the expression of LRP16, its interaction with ER
and its effect on ER
-mediated signaling. First, we showed that both mRNA and protein expression levels of LRP16 are positively linked with estrogen action in several breast cancer cell lines. Next, the proliferation rate of ER
-positive MCF-7 cells, but not ER
-negative MDA-MB-231 cells, was shown to be related to LRP16 expression levels. Furthermore, we showed that LRP16 enhanced the transcriptional activity of ER
. This provided evidence that LRP16 is not only a target gene of ER
but also a novel ER
coactivator, thus creating a positive regulatory feedback loop. Therefore, LRP16 may play an important role in the proliferation of ER
-positive breast cancer cells by amplifying the function of ER
.
| Materials and methods |
|---|
|
|
|---|
All cell lines were purchased from American Type Culture Collection (ATCC, Rockville, MD, USA) and cultured according to the instructions. Pure estrogen antagonist ICI 182 780 was provided by Dr Qinong Ye (College of Military Medicine Science of China). E2 was purchased from Sigma. Phenol red-free DMEM and estrogen-deprived fetal calf serum (FCS) were prepared as described previously (Zhao et al. 2005).
Cell proliferation assay
Cells were seeded at 1 x 104 per well in 24-well plates. After cell attachment, the medium was replaced with 1 ml fresh DMEM supplemented with 1% FCS. For each cell line, cells from three dishes were counted daily to generate proliferation curves. For the E2-stimulated proliferation experiment, a total of 5000 cells were seeded and cultured in each well of a 24-well plate in phenol red-free DMEM supplemented with charcoal-stripped FCS (5%). After 12 h, cells were treated with E2 in the same fresh medium for 24 h. Cell proliferation rate was quantified using CellTiter 96 Aqueous One Solution Cell Proliferation Assay (Promega). Each experiment was performed in triplicate and repeated on three occasions.
Plasmids
The mU6pro vector containing the mouse U6 snRNA promoter was kindly provided by Dr Turner from University of Michigan (Yu et al. 2002). Mammalian expression plasmid for ER
(pS5G-hER
) was provided by Prof. Hajime Nawata at Kyushu University, and the reporter 3 x ERE-TATA-Luc was provided by Prof. Donald P McDonnell at Duke University Medical Center (Norris et al. 1998). The fragment of –101 to –24 bp from the LRP16 upstream regulatory region containing multiple GC-rich sites was cloned into pGL3 basic vector as described (Si et al. 2006).
Two siRNA-coding oligonucleotides against human LRP16 were designed and verified to be specific to LRP16 by a Blast search against the human genome. The LRP16-siRNA-374-targeting sequence is AAGCAGCGGGAG GAACATTCA; the LRP16-siRNA-668-targeting sequence is AAGACTGGCAAGGCCAAGATC; the green fluorescent protein (GFP)-siRNA, which does not match any known human cDNA was used as control as described previously (Yu et al. 2002). The hairpin LRP16-siRNA-374, LRP16-siRNA-668 and GFP-siRNA oligonucleotides were chemically synthesized, annealed, and inserted into the mU6pro vector under the control of U6 snRNA promoter by BbsI and EcoRI sites. To construct the pLPC-based and siRNA-expressing retrovirus system, the elements including U6 snRNA promoter and the downstream hairpin siRNA insert from mU6 plasmid were subcloned into PCMVIE element-deleted pLPC vector by HindIII and EcoRI sites.
The human LRP16 full-length cDNA was cloned and inserted into the pcDNA3.1 expression vector as described previously (Han et al. 2003). The LRP16 cDNA with the Kozak sequence was also subcloned into the pcDNA3.1 expression vector to construct the pc3.1-K16. LRP16 cDNA was cloned into pGEX-6P-1 by EcoRI and HindIII sites to construct the glutathione S-transferase (GST)-LRP16 fusion. The truncated LRP16 fragment (coding 83–324 amino acids) was cloned into the pRSET-C vector by KpnI and BamHI sites for prokaryotic expression. The full-length LRP16, ER
cDNA, and its truncated fragments coding for AB, ABC, and DEF domains were cloned into either pBIND or pACT vectors by BamHI and KpnI sites to construct pBIND- and pACT-LRP16, pACT-ER
, pACT-ER
-AB, pACT-ER
-ABC, and pACT-ER
-DEF vectors. All the constructions were confirmed by restriction enzyme mapping and DNA sequencing.
Viral production and infection of target cells
293GP2 cells were plated into 10 cm dishes and cultured until reaching 80–90% confluency. pLPC-based plasmids (7.5 µg/well) and VSVG expression vector (2.5 µg/well) were transiently cotransfected into 293GP2 cells using Superfect transfection reagent (Qiagen) according to manufacturers protocol. After 2 days, the packaged pseudo-retrovirus in the supernatant was harvested by centrifugation at 8000 g for 10 min and was diluted 1:2 in DMEM. The retrovirus was then used to infect MCF-7 cells for an additional 48 h. Subsequently, MCF-7 cells were selected with 2 µg/ml puromycin (Invitrogen) for 2 weeks. All of the MCF-7 parental cells were killed by puromycin within this period. The selected cells were maintained as stably siRNA-expressing cells in DMEM supplemented with 1 µg/ml puromycin.
RNA extraction and northern blot analysis
Total RNA was extracted by TRIZOL reagent (Invitrogen) and analyzed by northern blot as described previously (Han et al. 2003). The membranes were probed to a 550 bp fragment of LRP16, a 1.6 kb fragment of ER
, 438 bp of c-fos, 744 bp of cathepsin D, 317 bp of RAR
, 780 bp of MTA3, 440 bp of pS2, and a 515 bp of ß-actin fragment labeled with [
-32P]dCTP by random priming.
Generation of LRP16 rabbit polyclonal antibody
The pRSET-C-LRP16 plasmid was transformed into the competent BL21 cells. Cells were cultured and 1 mM isopropyl-ß-thiogalactoside (IPTG) was added to induce the synthesis of recombinant protein. The bacteria were harvested and were lysed by sonication and the supernatant was collected by centrifugation. Proteins samples were run on SDS-PAGE and negatively stained with KCl (250 mM). The gel segments containing human truncated LRP16 recombinant protein (28 kDa) were cut out. The recombinant protein was extracted from frozen gels by dialysis and dissolved in PBS. The protein was diluted 1:1 in complete Freunds adjuvant for the first injection and incomplete Freunds adjuvant for subsequent injections. ELISA was done to measure the titer of serum from immunized rabbits. Pooled serum from days 120, 135, and 147 was purified using the ImmunoPure (A/G) IgG purification kit (Pierce Chemical Co., Rockford, IL, USA).
Antibodies and immunoblotting
Antibodies against ß-actin, cyclin D1, ER
(Santa Cruz, Biotechnology, Santa Cruz, CA, USA), and c-Myc (Invitrogen) were used in this study. All immunoblotting procedures were performed as described (Han et al. 2003).
Protein–protein interaction assays in cell-free (GST pull-down) and cell systems (coimmunoprecipitation, CoIP)
BL-21 bacteria were transformed with pGEX-6P-1 (GST alone) or GST-LRP16 and cultured in an incubator at 37 °C; 1 mM IPTG was added to the culture to induce expression of GST or GST-LRP16. Bacteria were pelleted and lysed in buffer (40 mM Tris–HCl (pH 7.5), 150 mM NaCl, 1 mM dithiothreitol, 1 mM EDTA, 0.5% NP40, 10% glycerol, 0.4 mM phenylmethylsulfonyl fluoride, 2 Ug/ml leupeptin, and 2 Ug/ml aprotinin) along with lysozyme (5 mg/l) and a bacterial protease inhibitor cocktail (Sigma). Suspensions were vortexed to resuspend the pellet, incubated on ice for 30 min, and sonicated for 5 min. The insoluble fraction was removed by centrifugation, and the supernatants incubated with glutathione-Sepharose beads (Amersham Bioscience) for 30 min at room temperature. For the pull-down assays, 30 µl of the 50% GST or GST-LRP16 bead slurry were incubated with 100 fmol of recombinant human ER
proteins (Invitrogen) supplemented with 10 nM E2 or DMSO at 4 °C for 3 h. To detect protein that bound specifically, the beads were washed six times with lysis buffer, boiled in SDS-PAGE samples buffer, and subjected to SDS-PAGE and analyzed by immunoblotting.
CoIP studies were performed using transfected cell lines. Briefly, MCF-7 cells were plated in 10 cm dishes and cultured using phenol red-free DMEM supplemented with 5% charcoal-stripped FCS until reaching 50–60% confluency. ER
and LRP16 expression vectors were cotransfected using Superfact transfection reagent (Qiagen). After 36 h, cells were treated with DMSO or 10 nM E2 for an additional 10 h and then lysed (20 mM Tris (pH 7.4), 50 mM NaCl, 1 mM EDTA, 0.5% NP-40, 0.5% SDS, 0.5% deoxycholate, and protease inhibitors). Five hundred nanograms of lysate were precleared with 50 µl protein A-Sepharose beads (Upstate Biotechnology, Lake Placid, NY, USA) and rabbit IgG for 2 h at 4 °C. Either anti-ER
(Santa Cruz, rabbit anti-hER
) or anti-LRP16 antibody (rabbit anti-human LRP16) was then added and incubated overnight at 4 °C. One hundred microliters of protein A agarose were then added to the antibody/lysate mixture for another 2 h at 4 °C, and the beads were pelleted and washed thrice with lysis buffer. Bound proteins were eluted in SDS sample buffer, subjected to SDS-PAGE, and analyzed by immunoblotting.
Luciferase reporter assays
Cells that had reached a 50% confluency rate in 35 mm dishes were cotransfected using Superfect (Qiagen). 3 x ERE-TATA-ZWc (0.25 ng) or LRP16 promoter gene construct, 0.25 ng ER
expression vector, and the LRP16 expression vector (pc3.1-K16) with the indicated amounts were used to cotransfect cells. SiRNA duplexes against the LRP16 gene (synthesized by JiKai Co., Shanghai, China), reporter genes, and ER
expression vector (1:1:0.5 µg) were cotransfected using LipofectAMIEN 2000 according to manufacturers recommendations (Invitrogen). pRL-SV40 was also cotransfected (1 ng/per well) and used as the internal control. Cell extracts were prepared 42 h after transfection, and the luciferase activity was measured using the Dual-Luciferase Reporter Assay System (Promega). All experiments were performed in triplicate and repeated thrice.
Mammalian two-hybrid assays
Mammalian two-hybrid assays (Promega) were performed according to manufacturers protocol with minor modifications. Briefly, MCF-7 cells were cultured in phenol red-free and steroid-deprived medium for at least 3 days, and then plated in 3.5 cm dishes. MCF-7 or 293T cells were transiently cotransfected with the indicated vectors using Superfect transfection reagent. Luciferase activities were assayed as described previously.
Statistical analysis
Experiments were performed in triplicate, and the results were expressed as the mean ± S.E.M. Statistical analysis was performed using Statview software. All data were evaluated for paired variables to compare two groups. P < 0.05 was considered to be statistically significant.
| Results |
|---|
|
|
|---|
Previously published work from our laboratory has demonstrated that E2 upregulated mRNA levels of the human LRP16 gene in MCF-7 cells (Han et al. 2003). To assess the effects of anti-estrogens on the expression level of LRP16, a more selective steroidal estrogen antagonist, ICI 182 780 (10 nM), was used to treat proliferating MCF-7 cells. Total RNA over a 24 h time course was extracted, and northern blot analysis was used to determine the mRNA level of LRP16. Figure 1A
demonstrated that the level of LRP16 mRNA decreased within 3 h of treatment. These results, combined with the induced effect of LRP16 expression by E2 as previously reported (Han et al. 2003), suggest that the LRP16 expression is dependent on estrogen action. To confirm this finding, we treated the endometrial cell line Ishikawa with E2 (10 nM) or estrogen antagonist ICI 182 780 (10 nM). The significant increase in LRP16 mRNA levels was observed after E2 stimulation; whereas, inhibition of ER
activity led to a decline in the expression of LRP16, but not ß-actin (Fig. 1A
). Next, we overexpressed ER
in Ishikawa cells cultured in normal medium, and observed an increase of LRP16 mRNA level (Fig. 1B
). We also followed the expression patterns of LRP16 mRNA in ER
-positive and ER
-negative human breast cancer cell lines by northern blot. The LRP16 transcript was differentially expressed and was only abundant in the ER
-positive MCF-7 and T47D cell lines (Fig. 1C
).
|
Suppression of LRP16 expression reduces estrogen-mediated proliferation response of MCF-7 cells
The dependence of LRP16 expression on estrogen activity led us to study different LRP16 expression levels and the proliferative properties of breast cancer. To do so, we chose several sequences in the coding region of the human LRP16 gene and designed short interfering RNAs (siRNA) targeted against each sequence. To test whether these siRNAs could suppress LRP16 expression in MCF-7 cells, we infected these cells with the retroviral vector transducing a DNA segment specifying such siRNA sequences and then selected the cells stably expressing the siRNA. An siRNA against GFP, whose sequence has previously been used as a control-siRNA in human cells (Yu et al. 2002), was also introduced into MCF-7 cells. As shown in Fig. 2A
, siRNA-374 and siRNA-668 caused a specific reduction in LRP16 gene expression level, leading to a 90 and 60% decrease respectively, of LRP16 mRNA relative to the control-siRNA. Consistent with the change in LRP16 mRNA, LRP16 protein was dramatically blocked by siRNA-374, and was partially silenced by siRNA-668.
|
Next, we stably transfected LRP16 cDNA with a modified Kozak sequence into MDA-MB-231 cells and observed that MDA-MB-231 cells carrying either pcDNA3.1-KLRP16 or empty vector grew at a similar rate (data not shown), indicating that LRP16 is not required for the proliferation of MDA-MB-231 cells.
Differential requirement of MCF-7 and MDA-MB-231 proliferation for LRP16 expression level as demonstrated above led us to speculate that the inhibition of MCF-7 proliferation by LRP16-siRNA resulted from the attenuated responsiveness of MCF-7 cells to estrogen. To test this hypothesis, the established stably transfected cell lines with different LRP16 expression levels were used to examine whether suppression of LRP16 has an anti-estrogenic activity on MCF-7 cell proliferation. E2 could stimulate proliferation of MCF-7 cells carrying either LRP16-siRNAs or control-siRNA in a dose-dependent manner, but the degree of stimulation of E2 on the cell proliferation of MCF-7 carrying LRP16-siRNAs was much less than that on the cell proliferation of MCF-7 carrying control-siRNA beginning from 10–11 to 10 –7 M/l of E2 treatment (Fig. 2C
). This indicated that LRP16 is required for the E2-stimulated proliferation of MCF-7 cells.
LRP16 modulates ER
-mediated transactivation
The effect of LRP16 on the proliferative response of MCF-7 to estrogen suggested that LRP16 participates in the genetic program initiated by ligand-bound ER
. We reasoned that LRP16 might directly regulate the ER
transcriptional activity. To address this question, the transcriptional activity of a 3 x ERE-TATA-Luc reporter gene was first assayed. In the presence of estrogen, LRP16 enhanced ER
-mediated transactivation of the reporter gene in a dose-dependent manner (Fig. 3A
). However, this effect was abolished when estrogen was stripped from the culture media. In contrast to MCF-7 cells, the weak intrinsic activation of LRP16 for ER
-mediated transcription was observed in a LRP16 dose-dependent manner in HeLa cells (Fig. 3A
). To further test the requirement for LRP16 of ER
-mediated transactivation in MCF-7 cells, we utilized RNA interference in the cotransfection system. Analysis of 3 x ERE-TATA-Luc reporter gene activities in this system revealed that the inhibition of LRP16 led to the decreased ER
-mediated transactivation in the presence of E2 (Fig. 3C
). In the absence of E2, inhibition of the endogenous LRP16 in MCF-7 cells did not decrease the reporter gene activities, confirming that LRP16 has no intrinsic activity for ER
-mediated transactivation in MCF-7 cells.
|
-mediated transactivation enhanced by LRP16, a promoter that lacked a classical ERE sequence but had E2 responsiveness was used. Several reports have demonstrated that the GC-rich region in the upstream regulatory region of ER
target genes is the main region to confer the E2 responsiveness (Watanabe et al. 1998, Safe 2001). The fragment from –101 to –24 bp of the LRP16 gene 5'-proximal region was identified to confer the E2-stimulated transcriptional activities through GC-rich sites, and we also confirmed that the transcriptional activity of LRP16 gene by E2 through this region is mediated through ER
–Sp1 interaction (Si et al. 2006). To test whether LRP16 is required for transcriptional activation of genes through ER
–Sp1 interaction, we utilized the LRP16 promoter (–101 to –24 bp)-luciferase fusion as a model promoter for this system. We observed the similar results by a GC-rich promoter and using the classical ERE promoter model in both MCF-7 and HeLa cells (Fig. 3B and C
To address the necessity for LRP16 in estrogen induction of ER
target genes, we chose several ER
target genes including c-fos, MTA3, pS2, RAR
, and cathepsin D to detect their estrogen response. All of the chosen targets genes are well- ocumented E2-induced genes in MCF-7 cells and their promoters contain either functional EREs or GC-rich Sp1-binding sites (Jeltsch et al. 1987, Weisz & Rosales 1990, Augereau et al. 1994, Sun et al. 1998, Fujita et al. 2004). Northern blot analyses demonstrated that the suppression of LRP16 gene expression in MCF-7 cells at least partially impaired the estrogen-mediated upregulation of all ER
target genes except cathepsin D at different culture conditions and time points (Fig. 4A
). Cyclin D1 and c-myc are two well-known cell cycle-related genes (Weisz & Bresciani 1988, Sabbah et al. 1999, Vastro-Rivera et al. 2001). The protein levels of both cyclin D1 and c-myc were measured in LRP16-inhibitory MCF-7 cells by immunoblotting. There was an observed parallel depletion of growth recovery with estrogen after synchronization with ICI 182 780 (Fig. 4B
). In addition, we also detected the ER
expression by immunoblotting, and the results confirmed that the suppression of LRP16 in MCF-7 cells did not change the ER
level (data not shown). These data excluded the fact that the attenuation of ER
-mediated transcription in LRP16-inhibitory cells could have been caused by the alteration of ER
expression itself. Finally, we concluded that LRP16 is required for ER
-mediated transactivation.
|

The evidence that LRP16 enhances the function of ER
transactivation prompted us to examine whether LRP16 protein binds to ER
. As shown in Fig. 5A
, LRP16 can bind to ER
in a GST pull-down assay, suggesting a direct interaction independent of estrogen stimulation in a cell-free system. By comparison of the intensity of the target bands in Fig. 5A
, it was observed that the interaction of LRP16 and ER
proteins was enhanced in the presence of E2. Subsequently, MCF-7 cells were cultured with phenol red-free DMEM supplemented with steroid-stripped serum for at least 3 days and cotransfected with LRP16 and ER
cDNA to determine whether LRP16 and ER
interact in a cell system. We used a rabbit anti-human ER
antibody to immunoprecipitate LRP16 from cell lysates, and immunoblotting with an anti-LRP16 antibody confirmed the interaction between ER
and LRP16 in the cell system irrespective of the presence of estrogen (Fig. 5B
). Next, we performed the same experiment in the reciprocal manner (i.e. immunoprecipitation with a LRP16 antibody and immunoblotting with a rabbit anti-human ER
antibody). Again we detected an interaction between LRP16 and ER
(Fig. 5B
). A comparison of the intensity of the target bands in Fig. 5B
confirmed that E2 enhanced the interaction of LRP16 and ER
since the cross-reaction of the IgG heavy chain with the secondary antibody serves as a loading control.
|
with LRP16
To define the individual domains of the ER
involved in binding to LRP16, mammalian two-hybrid assays were performed in MCF-7 and 293T cells. The ER
constructs were composed of amino acids 1–595 (pBIND-ER
), 1–263 (pBIND-ER
-ABC), 1–180 (pBIND-ER
-AB), and 263–595 (pBIND-ER
-DEF) fused to the DBD of GAL4; whereas, full-length LRP16 was fused to the VP16 activation domain (pACT-LRP16; Fig. 6A
). As shown in Fig. 6B
, the pG5-Luc reporter gene was induced in MCF-7 cells when pACT-LRP16 was cotransfected with pBIND-ER
, pBIND-ER
-ABC, or pBIND-ER
-AB construct but not with pBIND-ER
-DEF. The addition of E2 (10 nM) further enhanced the transcription by about 1.5-fold in the case of pBIND-ER
, but not with pBIND-ER
-ABC or pBIND-ER
-AB. In addition, results observed in 293T cells were similar to those described in MCF-7 cells (data not shown). To exclude possible vector-dependent transactivation (Finkel et al. 1993), we exchanged the vectors between LRP16 and the individual ER
domains and repeated the experiments. The results were consistent with the previous experiment (data not shown). These data indicated that LRP16 binds to the N-terminal A/B AF-1 but not AF-2 domain of ER
. Even though binding is not dependent on the presence of estrogens, E2 enhances LRP16 binding to the full-length ER
molecule, which is consistent with the results as shown in Fig. 5
.
|
| Discussion |
|---|
|
|
|---|
, a member of the NR family, has an established role in promoting breast cancer. ER
regulates the transcription of genes involved in breast cancer cell proliferation, invasion, and metastasis. In the complex regulation of ER
signal transduction, emerging evidence indicates that an auto-regulation loop could be an important model for ER
functional activity. For example, cyclin D1 is a well-documented estrogen target gene in many ER
breast cancer cell lines (Vastro-Rivera et al. 2001). Surprisingly, cyclin D1 has been shown to have a novel role in the growth regulation of estrogen-responsive tissues by activating ER
-mediated transcription in the absence of estrogen and enhancing transcription in its presence (Zwijsen et al. 1997). Several lines of evidence suggest that most of the ER
cofactor expression levels are not hormonally regulated (Misiti et al. 1998, Thenot et al. 1999, Vienonen et al. 2003). Yet, there is evidence that a number of cofactors themselves are regulated by E2. For example, the expression of the corepressor SHARP (SMART/HDAC1 associated repressor protein) is increased by E2 (Shi et al. 2001) and expression of the coactivator AIB1 is decreased (Lauritsen et al. 2002). This self-regulatory model can also be extended to other NR members. For example, the expression of the SWI3-related gene product (SRG3), which is developmentally regulated in the prostate, is induced by androgen through the androgen receptor (AR). SRG3 in turn enhances the transactivation of AR, providing a positive feedback loop in a NR signaling pathway (Hong et al. 2005). Importantly and interestingly, our results now document one feedback-enhancing pathway regulating ER
-mediated transcriptional activity by an estrogen-responsive gene, LRP16. This pathway may be involved in the progression of ER
-positive breast cancer and may reflect the self-maintaining nature of ER
signaling in estrogen-sensitive target cells.
Previous studies have demonstrated that E2 induced the upregulation of LRP16 mRNA and the reporter gene activity in ER
-positive MCF-7 cells (Han et al. 2003). However, the expression pattern of LRP16 gene has been shown to be ubiquitous in multiple human tissues, not exclusively in hormone-dependent tissues (Han et al. 2001). In this study, using several breast cancer cell lines and ER
modulation, we provide evidence to confirm the positive relationship between LRP16 expression and estrogen action. We have demonstrated consistent changes in LRP16 expression at both mRNA and protein levels (Fig. 1
). This link, initially derived from cell culture systems, is also supported by data from primary breast carcinomas. In clinical samples, LRP16 overexpression was observed in about 30–40% of primary breast carcinomas by northern blot and semi-quantitative RT-PCR analyses, and the positive status of ER
and PR were significantly linked to LRP16 expression level (Liao et al. 2006).
This study provides the first evidence for a functional role of LRP16 gene in strengthening the ER
-responsive gene activation and estrogen-dependent proliferation of breast cancer cells. Previously, we demonstrated that the ectopic expression of LRP16 promoted the proliferation of MCF-7 cells as well as a G1/S transition, meanwhile stimulating cyclin E expression but not p53, p21, and Rb expression (Han et al. 2003). In contrast, herein we show by siRNA knockdown approaches that inhibition of the endogenous LRP16 gene in MCF-7 cells suppresses cell growth. The experimental results including the fact that inhibition of LRP16 attenuated the E2-stimulated responsiveness of MCF-7 cells and that the enforced expression of LRP16 in ER
-negative MDA-MB-231 human breast cancer cells did not stimulate cell proliferation strongly suggest that LRP16 participates in ER
signaling. This prompted us to investigate the primary cell cycle checkpoint proteins that confer the mitogenic role of estrogen. Cyclin D1 and c-myc, two well-known ER
target genes, are believed to be sufficient to recapitulate the effects of estrogen on cell cycle progression (Prall et al. 1998b, Carrol et al. 2002). We show herein that the inhibition of LRP16 attenuated the induction of cyclin D1 and c-myc expression by E2 in MCF-7 cells (Fig. 4B
). In addition, the response defect of several ER
-induced genes for estrogen stimulation was also observed in LRP16-inhibitory MCF-7 cells (Fig. 4A
). In addition, we show by both ectopic expression and siRNA knockdown approaches that LRP16 enhances the transactivation of ER
-targeting promoters (Fig. 3
). In general, results from the cell growth study point to the possibility of LRP16-mediated modulation of the ER
-responsive transcription in cancer development.
The ligand-dependent activation of ER
requires the ligand-dependent association of coactivator complexes (Beato et al. 1995, Horwitz et al. 1996, Mckenna et al. 1999, Glass & Rosenfeld 2000). Presently, most transcriptional mediators and cofactors have been identified as interacting with and activating the AF-2 activity of ER
in a ligand-dependent fashion (Klinge 2000, Shao & Brown 2004). Although it has previously been reported that the full activation of the AF-1 domain containing in ER
can stimulate the proliferation of breast cancer cells (Fujita et al. 2003), less is known about the coactivators for N-terminal A/B AF-1 domain. The enhancement of ER
-mediated transactivation by LRP16 can be attributed to the formation of an LRP16/ER
functional complex. By cell-free and cell system assays, we first demonstrated that LRP16 physically interacts with ER
in a manner that is estrogen independent but appears to be enhanced by E2 (Fig. 5
). Further analyses showed that the region interacting with LRP16 was specifically located in the A/B region that contained the AF-1 domain of ER
. In addition, E2 enhanced the binding of LRP16 to the full-length ER
molecule but not to the AF-1 domain alone (Fig. 6
), suggesting that the interaction of LRP16 and certain cofactors was recruited to the AF-2 domain upon E2 stimulation. These results emphasized the possible mechanism of LRP16 modulating the cooperative interaction of AF-1 and AF-2 by interacting with other cofactors, since the maximally transcriptional activity of ER
was exhibited. The coactivator complex recruited for AF-2 that may interact with LRP16 after E2 treatment is being investigated in our laboratory. However, the differing impact of LRP16 on ER
-mediated transcriptional activity in the absence of E2 between MCF-7 and HeLa cells was observed in this study (Fig. 3A
), indicating cell-specific intrinsic activity of ER
by functional interaction of LRP16/ AF-1 domain.
Over the past decade, a large number of proteins have been identified that interact with and regulate transcriptional activity of ER
(Klinge 2000, Dobrzycka et al. 2003, Shao & Brown 2004). To our knowledge, there has been no recognition of an ER
cofactor regulated directly by ER
where the expression level is dependent on estrogen activity. ER
directly activates transcription of LRP16 in response to estrogen stimulation. Interestingly, LRP16, in turn, binds to ER
and enhances its transcriptional activity in the presence of a ligand signal. Ultimately, one biological output of estrogen signaling through the interaction of LRP16 and ER
manifests in the magnification of the ER
-mediated transactivation signal and the expression modulation of ER
target genes. The ability of ER
target gene LRP16 to functionally modulate ER
-mediated transcriptional activity contributes both to the complexity and the plasticity of the regulatory circuit.
Our findings could potentially have clinical benefits since an understanding of the activation linked to the expression of ER
may be important for endocrine therapy of ER
-positive breast cancer. Based on the mechanism of the ER
/LRP16 regulatory loop, we would like to propose that patients with high LRP16 expression might benefit from LRP16 targeting alongside with anti-estrogen therapy. LRP16 targeting could potentially improve the initial efficacy of therapy or delay the emergence of therapeutic resistance.
| Acknowledgements |
|---|
| References |
|---|
|
|
|---|
Augereau P, Miralles F, Cavailles V, Gaudelet C, Parker M & Rochefort H 1994 Characterization of the proximal estrogen-responsive element of human cathepsin D gene. Molecular Endocrinology 8 693–703.[Abstract]
Beato M, Herrlich P & Schutz G 1995 Steroid hormone receptors: many actors in search of a plot. Cell 83 851–857.[CrossRef][ISI][Medline]
Carrol JS, Swarbrick A, Musgrove EA & Sutherland RL 2002 Mechanisms of growth arrest by c-Myc antisense oligonucleotides in MCF-7 breast cancer cells: implication for the antiproliferative effects. Cancer Research 62 3126–3131.
Danielian PS, White R, Lees JA & Parker MG 1992 Identification of a conserved region required for hormone dependent transcriptional activation by steroid hormone receptors. EMBO Journal 11 1025–1033.[ISI][Medline]
Deroo BJ & Korach KS 2006 Estrogen receptor and human disease. Journal of Clinical Investigation 116 561–570.[CrossRef][ISI][Medline]
Dobrzycka KM, Townson SM, Jiang S & Oesterreich S 2003 Estrogen receptor corepressors-a role in human breast cancer? Endocrine-Related Cancer 10 517–536.[Abstract]
Endoh H, Maruyama K, Masuhiro Y, Kobayashi Y, Goto M, Tai H, Yanagisawa J, Metzger D, Hashimoto S & Kato S 1999 Purification and identification of p68 RNA helicase acting as a transcriptional coactivator specific for the activation function 1 of human estrogen receptor
. Molecular and Cellular Biology 19 5363–5372.
Finkel T, Duc J, Fearon ER, Dang CV & Tomaselli GF 1993 Detection and modulation in vivo of helix-loop-helix proteinprotein interactions. Journal of Biological Chemistry 268 5–8.
Foster JS & Wimalasena J 1996 Estrogen regulates activity of cyclin-dependent kinases and retinoblastoma protein phosphorylation in breast cancer cells. Endocrinology 10 488–498.[CrossRef]
Fujita T, Kobayashi Y, Wada O, Tateishi Y, Kitada L, Yamamoto Y, Takashima H, Murayama A, Yano T, Baba T et al. 2003 Full activation of estrogen receptor
activation function-1 induces proliferation of breast cancer cells. Journal of Biological Chemistry 278 26704–26714.
Fujita N, Kajita M, Taysavang P & Wade PA 2004 Hormonal regulation of metastasis-associated protein 3 transcription in breast cancer cells. Molecular Endocrinology 18 2937–2949.
Glass CK & Rosenfeld MG 2000 The coregulator exchange in transcriptional functions of nuclear receptors. Genes and Development 14 121–141.
Hall JM & McDonnell DP 2005 Coregulators in nuclear estrogen receptor action: from concept to therapeutic targeting. Molecular Interventions 5 343–357.
Hall JM, Couse JF & Korach KS 2001 The multifaceted mechanisms of estradiol and estrogen receptor signaling. Journal of Biological Chemistry 276 36869–36872.
Han WD, Yu L, Lou FD, Wang QS, Zhao Y, Shi ZJ, Jiao HY & Zhou JJ 2001 Cloning and expression characteristics of the full length cDNA for a novel leukemia-associated gene LRP16. Academic Journal of PLA Postgraduate Medical School 17 209–214.
Han WD, Mu YM, Lu XC, Xu ZM, Li XJ, Yu L, Song HJ, Li M, Lu JM, Zhao YL et al. 2003 Up-regulation of LRP16 mRNA by 17ß-estrodial through activation of estrogen
(ER
), but not ERß, and promotion of human breast cancer MCF-7 cell proliferation: a preliminary report. Endocrine-Related Cancer 10 217–224.[Abstract]
Hong CY, Suh JH, Kim K, Gong EY, Jeon SH, Ko M, Seong RH, Kwon HB & Lee K 2005 Modulation of androgen receptor transactivation by the SWI3-related gene product (SRG3) in multiple ways. Molecular and Cellular Biology 12 4841–4852.
Horwitz KB, Jackson TA, Bain DL, Richer JK, Takimoto GS & Tung L 1996 Nuclear receptor coactivators and corepressors. Molecular Endocrinology 10 1167–1177.[Abstract]
Jeltsch JM, Roberts M, Schatz C, Garnier JM, Brown AM & Chambon P 1987 Structure of the human oestrogen-responsive gene pS2. Nucleic Acids Research 15 1401–1414.
Klinge CM 2000 Estrogen receptor interaction with co-activators and co-repressors. Steroid 65 227–251.[CrossRef]
Lauritsen KJ, List HJ, Reiter R, Wellstein A & Riegel AT 2002 A role for TGF-beta in estrogen and retinoid mediated regulation of the nuclear receptor coactivator AIB1 in MCF-7 breast cancer cells. Oncogene 21 7147–7155.[CrossRef][ISI][Medline]
Lees JA, Fawell SE & Parker MG 1989 Identification of two transactivation domains in the mouse oestrogen receptor. Nucleic Acids Research 17 5477–5488.
Liao DX, Han WD, Zhao YL, Pu YD, Mu YM, Luo CH & Li XH 2006 The expression and clinical significance of LRP16 gene in human breast cancer. Ai Zheng 25 866–870.[Medline]
Mangelsdorf DJ, Thummel C, Beato M, Herrlich P, Schutz G, Umesono K, Blumberg B, Mark M, Chambon P & Evans RM 1998 The nuclear receptor superfamily: the second decade. Cell 83 835–839.[CrossRef]
Masood S 1992 Estrogen and progesterone receptors in cytology: a comprehensive review. Diagnostic Cytopathology 8 475–491.[ISI][Medline]
McDonnell DP & Norris JD 2002 Connections and regulation of the human estrogen receptor. Science 296 1642–1644.
McKenna NJ & OMalley BW 2002 Combinatorial control of gene expression by nuclear receptors and coregulators. Cell 108 465–474.[CrossRef][ISI][Medline]
McKenna NJ, Lanz RB & OMalley BW 1999 Nuclear receptor coregulators: cellular and molecular biology. Endocrine-Reviews 20 321–344.
Métivier R, Penot G, Flouriot G & Pakdel F 2001 Synergism between ER
transactivation function 1 (AF-1) and AF-2 mediated by steroid receptor coactivator protein-1: requirement for the AF-1
-helical core and for a direct interaction between the N- and C-terminal domains. Molecular Endocrinology 15 1953–1970.
Métivier R, Penot G, Húbner MR, Reid G, Brand H, Ko
M & Gannon F 2003 Estrogen receptor
directs ordered, cyclical, and combinatorial recruitment of cofactors on a natural target promoter. Cell 11 751–763.[CrossRef]
Misiti S, Schomburg L, Yen PM & Chin WW 1998 Expression and hormonal regulation of cofactor and corepressor genes. Endocrinology 139 2493–2500.
Nilsson S, Makela S, Treuter E, Tujague M, Thomsen J, Andersson G, Enmark E, Pettersson K, Warner M & Gustafsson JA 2001 Mechanisms of estrogen action. Physiological Reviews 81 1535–1565.
Norris JD, Fan D, Stallcup MR & McDonnell DP 1998 Enhancement of estrogen receptor transcriptional activity by the coactivator GRIP-1 hightlights the role of activation function 2 in determining estrogen receptor pharmacology. Journal of Biological Chemistry 273 6679–6688.
Planas-Silva MD & Weinberg RA 1997 Estrogen-dependent cyclin E-cdk2 activation through p21 redistribution. Molecular and Cellular Biology 17 4059–4069.[Abstract]
Prall OW, Sarcevic B, Musgrove EA, Watts CKW & Sutherland RL 1997 Estrogen-induced activation of Cdk4 and Cdk2 during G1-S phase progression ia accompanied by increased cyclin D1 expression and decreased cyclin-dependent kinase inhibitor association with cyclin E-Cdk2. Journal of Biological Chemistry 272 10882–10894.
Prall OW, Rogan EM & Sutherland RL 1998a Estrogen regulation of cell cycle progression in breast cancer cells. Journal of Steroid Biochemistry and Molecular Biology 65 169–174.[CrossRef][ISI][Medline]
Prall OW, Rogan EM, Musgrove EA, Watts CK & Sutherland RL 1998b c-Myc or Cyclin D1 mimics estrogen effects on Cyclin E-Cdk2 activation and cell cycle reentry. Molecular and Cellular Biology 18 4499–4508.
Sabbah M, Courilleau D, Mester J & Redeuilh G 1999 Estrogen induction of the cyclin D1 promoter: involvement of a cAMP response-like element. PNAS 96 11217–11222.
Safe S 2001 Transcriptional activation of genes by 17ß-estradiol through estrogen receptor-Sp1 interactions. Vitamins and Hormones-Advances in Research and Applications 62 231–252.
Shang Y, Hu X, DiRenzo J, Lazar MA & Brown M 2000 Cofactor dynamics and sufficiency in estrogen receptor-regulated transcription. Cell 103 843–852.[CrossRef][ISI][Medline]
Shao WL & Brown M 2004 Advances in estrogen receptor biology: prospects for improvements in targeted breast cancer therapy. Breast Cancer Research 6 39–52.[CrossRef][ISI][Medline]
Shi Y, Downes M, Xie W, Kao HY, Ordentlich P, Tsai CC, Hon M & Evans RM 2001 Sharp, an inducible cofactor that integrates nuclear receptor repression and activation. Genes and Development 15 1140–1151.
Si YL, Han WD, Zhao YL, Mu YM, Li Q & Wu ZQ 2006 5'-proximal GC-rich region of LRP16 genes determines its expression regulation by estrogen receptor
through Sp1 mediation. Academic Journal of PLA Postgraduate Medical School 27 161–165.
Sun G, Porter W & Safe S 1998 Estrogen-induced retinoic acid receptor
1 gene expression: role of estrogen receptor-Sp1 complex. Molecular Endocrinology 12 882–890.
Thenot S, Charpin M, Bonnet S & Cavailles V 1999 Estrogen receptor cofactors expression in breast and endometrial human cancer cells. Molecular and Cellular Endocrinology 156 85–93.[CrossRef][ISI][Medline]
Vastro-Rivera E, Samudio I & Safe S 2001 Estrogen regulation of cyclin D1 gene expression in ZR-75 breast cancer cells involves multiple enhancer elements. Journal of Biological Chemistry 275 30853–30861.
Vienonen A, Miettinen S, Manninen T, Altucci L, Wilhelm E & Ylikomi T 2003 Regulation of nuclear receptor and cofactor expression in breast cancer cell lines. European Journal of Endocrinology 148 469–479.[Abstract]
Watanabe T, Inoue S, Hiroi H, Orimo A, Kawashima H & Muramatsu M 1998 Isolation of estrogen-responsive genes with a GpC island library. Molecular and Cellular Biology 18 442–449.
Watanabe M, Yanagisawa J, Kitagawa H, Takeyama K, Ogawa S, Arao Y, Suzawa M, Kobayashi Y, Yano T, Yoshikawa H et al. 2001 A subfamily of RNA-binding DEAD-box proteins acts as an estrogen receptor
coactivator through the N-terminal activation domain (AF-1) with an RNA coactivator, SRA. EMBO Journal 206 1341–1352.[CrossRef]
Weisz A & Bresciani F 1988 Estrogen induces expression of c-fos and c-myc protooncogenes in rat uterus. Molecular Endocrinology 2 816–824.[Abstract]
Weisz A & Rosales R 1990 Identification of an estrogen response element upstream of the human c-fos gene that binds the estrogen receptor and the AP-1 transcription factor. Nucleic Acids Research 18 5097–6106.
Yu JY, DeRuiter SL & Turner DL 2002 RNA interference by expression of short-interfering RNAs and hairpin RNAs in mammalian cells. PNAS 99 6047–6052.
Zhao YL, Han WD, Li Q, Mu YM, Lu XC, Yu L, Song HJ, Li X, Lu JM & Pan CY 2005 Mechanism of transcriptional regulation of LRP16 gene expression by 17-ß estradiol in MCF-7 human breast cancer cells. Journal of Molecular Endocrinology 34 77–89.
Zwijsen RM, Wientjens E, Klompmaker R, van der Sman J, Bernards R & Michalides RJ 1997 CDK-independent activation of estrogen receptor by cyclin D1. Cell 88 405–415.[CrossRef][ISI][Medline]
| ||||||||||